D1.2 Protein synthesisIB Biology SL: Subtopic test
10 questions, 27 marks
IB Biology SL
D1.2 Protein synthesis
Total 27 marks
Name
Class
Date
- 1Cardiac muscle cells in an adult human rarely, if ever, divide, yet over several decades each cell transcribes many of its genes thousands of times. A short section of the template strand of one gene in such a cell has the base sequence TACGGATTC.(a)What is the base sequence of the mRNA transcribed from this section of the template strand?[1 mark]
- AAUGCCUAAG
- BATGCCTAAG
- CUACGGAUUC
- DTACGGATTC
(b)Which statement describes the role of RNA polymerase in transcription?[1 mark]- AIt joins amino acids together with peptide bonds
- BIt copies both strands of the gene into two RNA molecules
- CIt separates the DNA strands and links RNA nucleotides that pair with the template strand
- DIt links DNA nucleotides to form a new copy of the template strand
(c)Explain why the base sequence of the gene is not changed by repeated transcription, and why this matters in these cells.[2 marks]Total for question 1: 4 marks
- 2DNA contains four different bases, and the proteins of living organisms are built from 20 different amino acids. Of the 64 possible mRNA codons, 61 code for amino acids and 3 are stop codons. For example, GCU, GCC, GCA and GCG all code for alanine, whereas methionine has only one codon, AUG. The gene for green fluorescent protein (GFP) from the jellyfish Aequorea victoria has been inserted into bacteria, plants and mice, and in each case the cells produce the same fluorescent protein as the jellyfish.(a)Why must each codon consist of at least three bases?[1 mark]
- AEach codon of three bases codes for three amino acids
- BCodons of two bases would give only 16 combinations, fewer than the 20 amino acids
- CThree bases can form only 12 combinations, which is enough for the amino acids
- DThe ribosome can only bind three tRNA molecules
(b)Which feature of the genetic code is shown by the results with the GFP gene?[1 mark]- ADegeneracy
- BIt is a triplet code
- CIt contains stop codons
- DUniversality
(c)Explain what is meant by degeneracy of the genetic code and suggest one advantage of it.[2 marks]Total for question 2: 4 marks
- 3Part of the genetic code, given as mRNA codons: AUG methionine; GCU alanine; UGG tryptophan; AAA lysine; GAG glutamic acid; GAA glutamic acid; GUG valine; CAU histidine; UAA stop; UGA stop. A short mRNA has the base sequence AUGGCUUGGAAAGAGCAUUAA, read from the first base. Three mutant versions of the gene each have one base substitution. In mutant 1, base 15 of the mRNA changes from G to A. In mutant 2, base 14 changes from A to U. In mutant 3, base 9 changes from G to A.(a)Deduce the amino acid sequence of the polypeptide coded for by the normal mRNA and state the number of peptide bonds in it.[3 marks](b)Predict and explain the effect of each mutation on the polypeptide.[4 marks]
Total for question 3: 7 marks
- 4Haemoglobin in adult red blood cells contains two β-globin polypeptides. The β-globin gene is present in every body cell that has a nucleus, but it is transcribed at a high rate only in red blood cell precursors in the bone marrow; neurons and liver cells contain the gene but do not transcribe it. In people with sickle cell disease, one base in the β-globin gene is substituted: the triplet CTC on the template strand becomes CAC. As a result, the sixth amino acid of β-globin is valine instead of glutamic acid. Glutamic acid has a charged, hydrophilic R group; valine has a non-polar, hydrophobic R group. At low oxygen concentrations, sickle haemoglobin molecules stick together to form long fibres that distort red blood cells into a rigid sickle shape.(a)Explain how the β-globin gene is expressed to produce the polypeptide in a red blood cell precursor, and why the polypeptide is not made in neurons.[6 marks](b)Using the information, discuss how a single base substitution can have major effects on a protein and on the organism.[6 marks]
Total for question 4: 12 marks
End of questions